The nucleotide sequence of 5S rRNA from Scenedesmus obliquus.
نویسندگان
چکیده
The nucleotide sequence of the cytoplasmic 5S ribosomal RNA from Scenedesmusobliquus has been determined using post-labelling techniques. The sequence is closely related to the 5S RNA sequence of Chlorella and contains all the areas of invariant sequence which appear to be conserved in plant cytoplasmic 5S RNA species.
منابع مشابه
The complete mitochondrial DNA sequence of Scenedesmus obliquus reflects an intermediate stage in the evolution of the green algal mitochondrial genome.
Two distinct mitochondrial genome types have been described among the green algal lineages investigated to date: a reduced-derived, Chlamydomonas-like type and an ancestral, Prototheca-like type. To determine if this unexpected dichotomy is real or is due to insufficient or biased sampling and to define trends in the evolution of the green algal mitochondrial genome, we sequenced and analyzed t...
متن کاملA self-splicing group II intron in the mitochondrial large subunit rRNA (LSUrRNA) gene of the eukaryotic alga Scenedesmus obliquus.
The DNA sequence has been determined of the 3' terminus from the mitochondrial large subunit ribosomal RNA (LSUrRNA) gene of the eukaryotic green alga Scenedesmus obliquus (strain KS3/2). The gene contains two intervening sequences with characteristic sequence motifs of group II and group I introns respectively. The exon/intron boundaries of the introns have been revealed by sequence determinat...
متن کاملPhosphate and nitrate removal from municipal wastewater by algae Scenedesmus obliquus cultivation and production of algal biomass
Nitrate and phosphate are abundant in urban wastewater. We evaluated the efficiency of nitrate and phosphate removal from wastewater by Scenedesmus obliquus and its use as a medium for Scenedesmus obliquus. Samples were collected from the effluent of central wastewater treatment in Gorgan. This experiment was done by 3 treatments and 6 replications that effluent with 100%, 50% and 0% were dilut...
متن کاملThe nucleotide sequence of 5S rRNA from a red alga, Porphyra yezoensis.
The nucleotide sequence of 5S rRNA from Porphyra yezoensis has been determined to be: pACGUACGGCCAUAUCCGAGACACGCGUACCGGAACCCAUUCCGAAUUCCGAAGUCAAGCGUCCGCGAGUUGGGUUAGU - AAUCUGGUGAAAGAUCACAGGCGAACCCCCAAUGCUGUACGUC. This 5S rRNA sequence is most similar to that of Euglena gracilis (63% homology).
متن کاملNucleotide sequence of the 5S ribosomal RNA gene of Bartonella bacilliformis.
Eubacterial rRNA genes are usually organized in opeirons containing the 16S, 23S and 5S rRNA genes, in that order (I). A cluster of structural rRNA genes was discovered during nucleotide sequencing of a cloned 3.6-kb BamiiHI fragment of DNA from B. bacillifornis, the agent of Oroya fever in humans. The 5S rRNA gene is 119 bp in length and is located 107 bases 3' to the 23S rRNA gene of the bact...
متن کاملذخیره در منابع من
با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید
عنوان ژورنال:
- Nucleic acids research
دوره 10 20 شماره
صفحات -
تاریخ انتشار 1982